Question

A DNA sequence undergoes three subsequent point mutations which result in subsequent changes in the transcription of mRNA as shown below:
Original mRNA: $AUGCAUCUCACGGAUUAG$
Point mutation $1:$ $AUGCAUCUUACGGAUUAGUGCAUCUUACGGAUUAGGCAUCUUACGGAUUAGCAUCUUACGGAUUAGAUCUUACGGAUUAGUCUUACGGAUUAGCUUACGGAUUAGUUACGGAUUAGUACGGAUUAGACGGAUUAGCGGAUUAGGGAUUAGGAUUAGAUUAGUUAGUAGAGG$
Point mutation $2:$ $AUGCAUGCUUACGGUAUA$
Point mutation $3:$ $AUGCAUGCUUAAGGUAUA$
Select the correct sequence of point mutations that occurred in DNA.

• A. Missense mutation- Frame shift mutation- Nonsense mutation
• B. Silent mutation- Nonsense mutation- Frame shift mutation
• C. Silent mutation- Frame shift mutation- Nonsense mutation
• D. Missense mutation- Frame shift mutation- Silent mutation

Answer 1

Answer: (C)

Mutation is any change in the sequence of the DNA and if such a change occurs in single nucleotide, it is called point mutation. It can be due to addition, deletion or substitution.
The given sequence of mRNA is $AUGCAUCUCACGGAUUAG$ .
In the first point mutation there is change in single nucleotide in third codon. In CUC, last C is replaced by U. This mutation does not have much effect due to wobble nature of codons described by Wobble hypothesis. Such mutation is referred to as silent mutation.
In the second point mutation, there is addition of G base between second and third codon. This addition caused change in the reading frame of the codons. CUU has been replaced with $GCU,ACGbyUAC,GAU$ by GGU, UAG by AUA causing change in the amino acids translation and sequence. Such mutation where the reading frame shifts or changes is called frame shift mutation.
Third point mutation, the 4th codon UAC, C is replaced by A making the triplet UAA which is a stop codon. Because of the presence of stop codon, the translation abruptly stops leading to formation of a different type of protein. Such mutation where stop codon is formed due to change in base pair is called non-sense mutation.